Imegen

Polimorfismo en los genes TLR5 y TLR9 en una cohorte de pacientes venezolanos con Fibrosis Quística

Karen Sánchez1, Mariemily Silva1, Gerald Mejía1, Mercedes Fernándes-Mestre2 y Howard Takiff3.

1 Unidad de Estudios Genéticos y Forenses, Instituto Venezolano de Investigaciones Científicas.

2 Laboratorio de Fisiopatología, Inmunogenética, Instituto Venezolano de Investigaciones Científicas.

3 Laboratorio de Genética Molecular, Instituto Venezolano de Investigaciones Científicas.

 Autor de Correspondencia: PhD. Karen Sánchez, e-mail: ksanchezluquez@gmail.com.

 

ICONO-PDF-e1342620452384Artículo completo en PDF

Español


Resumen

Antecedentes y objetivos: los genes que codifican para los receptores toll (TLRs) han sido clasificados como genes moduladores de la fibrosis quística (FQ). La identificación y estudio de polimorfismos en estos genes contribuiría a profundizar en el conocimiento de la fisiopatología de la enfermedad, mejorar su pronóstico y potencialmente, diseñar terapias personalizadas. Con este fin, se planteó determinar la presencia de la variante c.1174C>T (rs5744168) del gen TLR5 y la variante c.-1486T>C (rs187084) del gen TLR9 en individuos venezolanos con FQ. Individuos y métodos: se incluyeron 41 individuos diagnosticados clínicamente de FQ (n=41). El diagnóstico molecular de FQ y los polimorfismos en genes Toll se determinaron por secuenciación directa. Resultados: para la variante c.-1486T>C del gen TLR9 la frecuencia alélica encontrada fue 0,57 para el alelo T y 0,43 para el alelo C. No se observó la presencia del polimorfismo TLR5 c.1174C>T. Conclusiones: este estudio representa un primer reporte, en pacientes venezolanos, que evalúa polimorfismos funcionales en genes moduladores de FQ. Se detecta la variable c.-1486T>C del gen TLR9 y se sugiere ampliar el estudio para evaluar su posible asociación con sintomatología clínica en estos pacientes.

English


ABSTRACT

Background and objectives: the genes encoding toll receptors (TLRs) have been classified as cystic fibrosis (CF) modulating genes. The identification and the study of polymorphisms in these genes would contribute to deepen our knowledge of the pathophysiology of the disease, improve its prognosis and potentially aid in the design of personalized therapies. To this end, the presence of variant c.1174C> T (rs5744168) of the TLR5 gene and the variant c.-1486T> C (rs187084) of the TLR9 gene were determined in Venezuelan individuals with CF. Individuals and methods: We included 41 individuals clinically diagnosed with CF (n = 41). Molecular diagnosis of CF and polymorphisms in Toll genes were determined by direct sequencing. Results: For the c.-1486T> C variant of the TLR9 the gene allelic frequency was 0.57, and for the T allele and 0.43 for the C allele. The TLR5 c.1174C> T polymorphism was not observed. Conclusions: This study represents a first report, in Venezuelan patients, that evaluates functional polymorphisms in CF modulator genes. The variable c.-1486T> C of the TLR9 gene was detected and we suggest to extend the study to evaluate its possible association with the clinical symptomatology in these patients.

 

Keywords: Alleles, Polymorphisms, TLRs, Cystic Fibrosis, Modifier genes

Palabras clave: Alelos, Polimorfismos, TLRs, Fibrosis quística, Genes Modificadores

 

INTRODUCCIÓN

La Fibrosis Quística (FQ) es una enfermedad monogénica causada por mutaciones en el gen codificante de la proteína reguladora transmembrana de la fibrosis quística (CFTR, por sus siglas en inglés) (OMIM: 602421). Los pacientes con FQ presentan una gran variabilidad clínica, en sus formas más severas, se generan alteraciones que confieren una susceptibilidad anormal para colonización endobronquial crónica por bacterias, como Pseudomonas aeruginosa, entre otras (Agudelo et al., 2008).

La enfermedad pulmonar, principal causa de muerte en estos pacientes, está asociada a la inflamación producto de las infecciones bacterianas y a la variabilidad fenotípica que se presenta en esta enfermedad. La presencia de distintas mutaciones en el gen CFTR, la acción de genes moduladores y la incidencia de factores medioambientales, dificultan el diagnóstico y el tratamiento de estos pacientes (Gallati, 2014; Orozco et al., 2006). La identificación de polimorfismos en genes moduladores de la fisiopatología de la enfermedad y que condicionan el pronóstico así como la variabilidad clínica de la FQ es clave para profundizar en el conocimiento de la patogenia de la enfermedad e identificar potenciales dianas terapéuticas en otros genes (Gallati, 2014), facilitando la aplicación de  tratamientos más individualizados en pacientes con FQ (Orozco et al., 2006).

Los receptores tipo toll (TLRs) implicados en la respuesta inmunitaria innata han sido estudiados como genes moduladores de la FQ, específicamente los receptores TLR5 y TLR9, por su participación en procesos infecciosos mediante el reconocimiento de patrones moleculares asociados a patógenos (Greene et al., 2005; Haerynck et al., 2013). La variante TLR5 c.1174C>T codifica un codón de parada prematuro (p.Arg392Stop), Blohmke et. al. (Blohmke et al., 2010) describió la reducción del 45,5-76,3% en la respuesta anti-inflamatoria a flagelina en presencia de esta variante, sugiriendo al gen TLR5 como un gen modulador de la FQ. Este mismo grupo, describe una asociación ente la presencia de la variante c.1174C>T y un mayor índice de masa corporal en estos pacientes, relacionándola con mejoras en la salud de los pacientes con FQ (Blohmke et al., 2010). El TLR5 también es considerado como un posible blanco anti-inflamatorio (Gallati, 2014), de potencial uso en estos pacientes.

Se ha descrito que la activación de TLR9 por sus agonistas, induce respuestas proinflamatorias en líneas celulares de epitelio respiratorio de FQ (Greene et al., 2005). La deficiencia en la capacidad de defensa del hospedador es capaz de modificar el defecto básico en FQ, que se define como un deterioro de la conductancia de cloruro en el epitelio mediada por la proteína CFTR (Stanke et al., 2011), una asociación moderada entre el genotipo del receptor TLR9 y el fenotipo del defecto básico de FQ fue confirmada por el grupo de Stanke et al (Stanke et al., 2008). Varios estudios han examinado la funcionalidad del SNP c.-1486T>C en el gen TLR9, demostrando que en condiciones basales el alelo C del SNP c.-1486T>C está asociado con una menor expresión del receptor TLR9 (Elmaagacli et al., 2009; Tao et al., 2007). Estos resultados confirman otros estudios que evidencian la existencia de señalización cruzada entre el sistema inmunitario y las propiedades secretoras de las células epiteliales (Galietta et al., 2004). Adicionalmente, se han diseñado agonistas de TLR9 que pudieran ser utilizados como adyuvantes de vacunas eficaces en enfermedades infecciosas (Jurk & Vollmer, 2007), de potencial uso en individuos con FQ.

Al considerar que polimorfismos en los genes de los receptores TLR5 y TLR9 puedan contribuir con el conocimiento de la fisiopatología y variabilidad fenotípica de la FQ, nos planteamos como objetivo determinar la presencia de la variante c.1174C>T (rs5744168) del gen TLR5 y la variante c.-1486T>C (rs187084) del gen TLR9 en individuos venezolanos con fibrosis quística con el fin de determinar si pueden ser considerados SNPs candidatos a evaluar en estos genes moduladores de FQ en pacientes venezolanos.

 

MATERIALES Y MÉTODOS:

 Pacientes

De un registro de 110 pacientes de igual número de familias no vinculadas registradas en el Programa Nacional de FQ del Ministerio de Salud de Venezuela, participaron en este estudio 41 individuos, de edad promedio: 9 años (rango de edad 1-27años), 17 pacientes de sexo femenino (41,46%) y 24 de sexo masculino (58,64%), nacidos en Venezuela, con diagnóstico clínico de fibrosis quística, algunos datos epidemiológicos y clínicos se describen en la tabla 1. Estos pacientes poseen una historia médica que cumplen con los criterios clínicos establecidos para el diagnóstico clínico de fibrosis quística sugeridos según estándares internacionales (Farrell et al., 2008), presentando síntomas y signos clásicos de la enfermedad así como resultados de exámenes de laboratorio confirmatorios.

Todos los individuos participantes en el estudio y/o su representante legal (en caso de los menores de edad) firmaron un consentimiento informado. Dicho consentimiento fue aprobado por el Comité de Bioética del Instituto Venezolano de Investigaciones Científicas y el de los centros médicos. La información personal, social, clínica y genética de los individuos participantes fue registrada y archivada bajo formatos de estándares internacionales.

 

Tabla 1. Datos epidemiológicos y clínicos de los pacientes incluidos en el estudio.

PacienteSexoEdad (años)Valor Test sudor (mmol/L)N° mutaciones  CFTR detectadas
1er resultado2do resultado
1M1211
2F639370
3F1840341
4M1462620
5M3632
6M869242
7F570682
8M27781
9F478781
10M4822
11F1822
12F1822
13M283722
14M489882
15M1491801
16M1492762
17M1492791
18M393842
19M1396660
20F3106982
21M101071
22F6109692
23F201092
24F51111082
25M6111872
26F121131002
27M41151002
28M4117922
29F101241
30M51291092
31F141341271
32F21381252
33M161381162
34F231391192
35M141521522
36M91541272
37F221701272
38F1–  (*)2
39M12
40M12
41M22DNDDND2

Los resultados de electrolitos en sudor, se reportan en mmol/L, considerando un valor intermedio de <30 – 59 mmol/L y un valor alto >60mmol/L (Sosnay et al., 2017). (-): No realizado al momento del estudio. DND: Dato no disponible al momento del estudio. (*) paciente fallecida.

 

Extracción del ADN genómico

El ADN genómico fue extraído de los leucocitos y linfocitos de sangre periférica utilizando el estuche CASE Work IQ (Promega), siguiendo las instrucciones de la casa comercial.

Estudio genético :

Genotipificación del gen CFTR: En los 41 pacientes la detección de las mutaciones del gen CFTR fue llevada a cabo por secuenciación directa de los 27 exones del gen, utilizando los iniciadores diseñados y descritos por Zielenski et al.(Zielenski et al., 1991), siendo parte de una cohorte de pacientes con FQ, cuyos resultados genéticos fueron previamente analizados y publicados (Sánchez et al., 2016; Sánchez et al., 2014). Sin embargo, ya que estudian regiones intrónicas, ni el alelo poliT del intrón 8, ni se incluye el estudio de grandes deleciones y duplicaciones, los resultados obtenidos no excluyen la presencia de otras mutaciones en el gen CFTR.

Genotipificación de los genes TLR 5 y TLR 9: El polimorfismo (c.1174C>T; p.Arg392stop) (rs5744168) del gen TLR5 se determinó por secuenciación, utilizando los iniciadores TLR5-Fw: TTACAGACCTTGAGTCTCC y TLR5-Rv: CAGAATCTGGAGATGAGGTACCCG (Blohmke et al., 2010). El polimorfismo c.-1486T>C (rs187084) del gen TLR9, se determinó por secuenciación utilizando los iniciadores TLR9-Fw: ACTATGGAGCCTGCCTGCCATGATACC y TLR9-Rv: ATCCAGCCTTCTTACAAACCTCCCACCC (Berghöfer et al., 2005).

La secuenciación del gen CFTR y la determinación de las variantes de los genes TLR5 y TLR9 fue realizada con un secuenciador 3130xl (Applied Biosystems). La química utilizada fue BigDye Terminator 3.1. Los resultados obtenidos se analizaron con el programa Sequencing Analysis v5.3 y SeqScape v2.5 (Applied Biosystems).

Análisis Estadístico.

Las frecuencias genotípicas y alélicas fueron calculadas por contaje directo. Se realizó la prueba de equilibrio para determinar la distribución genotípica de los polimorfismos estudiados de acuerdo a Hardy-Weinberg (H-W).

 

RESULTADOS

Distribución de las frecuencias de las mutaciones del gen CFTR

La tabla 2 muestra la frecuencia genotípica de la evaluación genética, una vez examinados los 27 exones del gen CFTR por cada individuo (Sánchez et al., 2016; Sánchez et al., 2014). De los 41 pacientes incluidos, 29 pacientes (71%) presentaron dos alelos mutados causantes de FQ, 9 pacientes (22%) solo un alelo mutado y 3 pacientes (7%) ningún alelo mutado. Solo se consideraron mutaciones no sinónimas y sugestivas de ser causales de FQ. En total se detectaron 16 alelos, generando 16 genotipos diferentes, siendo el más frecuente el p.Phe508del/p.Phe508del (44%).

 

Tabla 2: Frecuencia genotípica de mutaciones en el gen CFTR en pacientes con FQ.

Genotipo Gen CFTR

  
Alelo 1Alelo 2Frecuencia Número de pacientes (n=41)
p.Phe508delp.Phe508del43.918
p.Phe508delp.Asn1303Lys4.92
p.Phe508delp.Tyr109Cys2.41
p.Phe508delp.Trp277*2.41
p.Phe508delp.Arg334Trp2.41
p.Phe508delp.Ser549Arg2.41
p.Phe508delp.Arg553*2.41
p.Phe508delp.Leu558Ser2.41
p.Phe508delp.Arg1066Cys2.41
p.Phe508delp.Arg1158*2.41
p.Gly542*p.Glu1308*2.41
p.Phe508del7.33
p.Gly542*4.92
p.Arg1162*4.92
p.Asn900Lys2.41
p.Tyr1015Cys2.41
7.33

La frecuencia está expresada en porcentaje. (-) No fueron detectadas mutaciones en las regiones evaluadas.

 

Distribución de la frecuencias alélicas y genotípicas del gen TLR5 y TLR9

El polimorfismo c.1174C>T del gen TLR5 está ausente en los individuos analizados. En contraste, se observó la presencia de los tres genotipos posibles para el polimorfismo c.-1486T>C del gen TLR9 (Tabla 3). Los resultados sugieren que la distribución de las frecuencias se ajustan al modelo del equilibrio de Hardy-Weinberg en la distribución de genotipos en pacientes (X2 = 2,03; p> 0,05).

 

Tabla 3: Frecuencia genotípica y alélica del polimorfismo c.-1486T>C del gen TLR9 en pacientes con FQ.

TLR9 c.-1486T>C

Pacientes (n=41)

Genotipos

T/T

29 (12)

C/T

56 (23)

C/C

15 (6)

Alelos

T

57 (47)

C

43 (35)

Los valores mostrados en paréntesis representan el número de individuos portadores del genotipo estudiado. La frecuencia está expresada en porcentaje.

 

En ningún caso fueron detectadas otras variantes dentro de las regiones secuenciadas.

 

DISCUSIÓN y CONCLUSIÓN:

La enfermedad pulmonar, asociada a la inflamación de las infecciones bacterianas y a la variabilidad fenotípica que se presenta en pacientes con FQ, dificulta el diagnóstico, pronóstico y el tratamiento de esta enfermedad. La correcta selección y estudio de polimorfismos en genes moduladores de la enfermedad, como los TLRs, constituyen piezas claves para proporcionar mayor entendimiento de la fisiopatología de la misma y potencialmente contribuir al desarrollo de tratamientos más individualizados.

En el presente estudio, se incluyeron, individuos tanto venezolanos de tercera generación como descendientes de poblaciones afroamericanas y caucásicas. Todos los pacientes presentan sintomatología clínica compatible con la enfermedad, en el 71% dos mutaciones causales de FQ fueron detectadas, en el 22% al menos una mutación causal fue detectada, considerado como un hallazgo confirmatorio y no excluyente en pacientes con clínica de FQ (De Boeck et al., 2006) y en el 7% de los pacientes ninguna mutación fue detectada. La ausencia de detección puede atribuirse a que, solo fueron sequenciados los exones del gen CFTR (no se incluyeron regiones intrónicas ni grandes deleciones y/o duplicaciones), aunado a que la población venezolana es altamente mestiza, dando lugar a la posibilidad de la existencia de nuevas variantes con efecto aún no estudiado, estos resultados concuerdan con los reportados para otros países de América latina (Pérez et al., 2007)

Considerando que la inhibición de TLR5 normaliza la respuesta inflamatoria generada por células epiteliales en las vías respiratorias de pacientes con FQ después de la exposición bacteriana (Blohmke et al., 2008)  y debido a que hay evidencias de que las estrategias terapéuticas que inhiben la actividad del receptor TLR5 pueden ser beneficiosos para los pacientes con FQ (Blohmke et al., 2010), era de nuestro interés evaluar la presencia de este polimorfismo c.1174C>T del gen TLR5 en nuestra población, sin embargo, el alelo T no fue detectado, en contraste a lo descrito en poblaciones afroamericanas y europeas (0,06 y 0,07 respectivamente, NCBI: ss7988260). Sugerimos un estudio mas amplio para confirmar estos resultados.

En el gen TLR9, el alelo C del SNP c.-1486T>C está asociado con una menor expresión del receptor TLR9 (Elmaagacli et al., 2009; Tao et al., 2007). Este estudio permitió detectar la presencia individuos homocigotos para esta variante (CC: 15%), siendo la frecuencia de este alelo C en nuestra población de 0,43 y del alelo T de 0,57, similar a la descrita en poblaciones afroamericanas y europeas (0,625 y 0,659 respectivamente, NCBI: ss7987856 y ss68861046). Sugerimos esta variante como candidata para realizar un estudio más amplio y evaluar su posible asociación con sintomatología clínica en los pacientes estudiados. No se descarta también incluir la evaluación otros polimorfismos presentes en genes TLRs, así como en otros genes moduladores de la FQ.

 

Agradecimientos:

Agradecemos al personal médico del Programa Nacional de Fibrosis Quística, a los pacientes y familiares que colaboraron con este estudio.

 

Referencias:

Agudelo AM, et al. Manual de pediatria ambulatoria / Manual of Ambulatory Pediatrics. Jan 2008, Ed. Médica Panamericana. ISBN: 978-958-44-1019-1.

Berghöfer B, et al. Common human Toll-like receptor 9 polymorphisms and haplotypes: association with atopy and functional relevance. Clin Exp Allergy J Br Soc Allergy Clin Immunol. Sep 2005, 35(9), 1147–1154. doi: 10.1111/j.1365-2222.2005.02325.x.

Blohmke CJ, et al. Innate immunity mediated by TLR5 as a novel antiinflammatory target for cystic fibrosis lung disease. J Immunol Baltim Md 1950. Jun 1, 2008, 180(11), 7764–7773.

Blohmke CJ, et al. TLR5 as an anti-inflammatory target and modifier gene in cystic fibrosis. J Immunol Baltim Md 1950. Dec 15, 2010, 185(12), 7731–7738. doi: 10.4049/jimmunol.1001513.

De Boeck K, et al. Cystic fibrosis: terminology and diagnostic algorithms. Thorax. Jul 2006, 61(7), 627–635. doi: 10.1136/thx.2005.043539.

Elmaagacli AH, et al. Improved outcome of hematopoietic SCT in patients with homozygous gene variant of Toll-like receptor 9. Bone Marrow Transplant. Sep 2009, 44(5), 295–302. doi: 10.1038/bmt.2009.32.

Farrell PM, et al. Guidelines for diagnosis of cystic fibrosis in newborns through older adults: Cystic Fibrosis Foundation consensus report. J Pediatr. Aug 2008, 153(2), S4–S14. doi: 10.1016/j.jpeds.2008.05.005.

Galietta LJV, et al. Effect of inflammatory stimuli on airway ion transport. Proc Am Thorac Soc. 2004, 1(1), 62–65. doi: 10.1513/pats.2306017.

Gallati S. Disease-modifying genes and monogenic disorders: experience in cystic fibrosis. Appl Clin Genet. 2014, 7, 133–146. doi: 10.2147/TACG.S18675.

Greene CM, et al. TLR-induced inflammation in cystic fibrosis and non-cystic fibrosis airway epithelial cells. J Immunol Baltim Md 1950. Feb 1, 2005, 174(3), 1638–1646.

Haerynck F, et al. Genetic variations in toll-like receptor pathway and lung function decline in Cystic fibrosis patients. Hum Immunol. Dec 2013, 74(12), 1649–1655. doi: 10.1016/j.humimm.2013.08.282.

Jurk M & Vollmer J. Therapeutic applications of synthetic CpG oligodeoxynucleotides as TLR9 agonists for immune modulation. BioDrugs Clin Immunother Biopharm Gene Ther. 2007, 21(6), 387–401.

Orozco L, et al. [Cystic fibrosis: molecular update and clinical implications]. Rev Investig Clínica Organo Hosp Enfermedades Nutr. Apr 2006, 58(2), 139–152.

Pérez MM, et al. CFTR gene analysis in Latin American CF patients: heterogeneous origin and distribution of mutations across the continent. J Cyst Fibros Off J Eur Cyst Fibros Soc. May 2007, 6(3), 194–208. doi: 10.1016/j.jcf.2006.07.004.

Sánchez K, et al. Analysis of the CFTR gene in Venezuelan cystic fibrosis patients, identification of six novel cystic fibrosis-causing genetic variants. Appl Clin Genet. 2016, 9, 33–38. doi: 10.2147/TACG.S78241.

Sánchez K, et al. Frequency of common CFTR gene mutations in Venezuelan patients with cystic fibrosis. Investig Clínica. Mar 2014, 55(1), 44–54.

Sosnay PR, et al. Diagnosis of Cystic Fibrosis in Nonscreened Populations. J Pediatr. Feb 2017, 181S, S52–S57.e2. doi: 10.1016/j.jpeds.2016.09.068.

Stanke F, et al. Diversity of the basic defect of homozygous CFTR mutation genotypes in humans. J Med Genet. Jan 2008, 45(1), 47–54. doi: 10.1136/jmg.2007.053561.

Stanke F, et al. Genes that determine immunology and inflammation modify the basic defect of impaired ion conductance in cystic fibrosis epithelia. J Med Genet. Jan 2011, 48(1), 24–31. doi: 10.1136/jmg.2010.080937.

Tao K, et al. Genetic variations of Toll-like receptor 9 predispose to systemic lupus erythematosus in Japanese population. Ann Rheum Dis. Jul 2007, 66(7), 905–909. doi: 10.1136/ard.2006.065961.

Zielenski J, et al. Genomic DNA sequence of the cystic fibrosis transmembrane conductance regulator (CFTR) gene. Genomics. May 1991, 10(1), 214–228.

 

Artículo recibido: 28 octubre 2016
Artículo aceptado: 14 febrero 2017
Artículo publicado: 23 febrero 2017

 

 

Si te ha gustado el artículo, suscríbete ahora de forma gratuita a la Revista Genética Médica y recíbela cada 2 semanas.


Acepto el Aviso Legal

You may also like...

Deja un comentario

Tu dirección de correo electrónico no será publicada. Los campos obligatorios están marcados con *

Normas de uso

La Revista Genética Médica permite realizar comentarios sobre su contenido para favorecer la participación de los lectores, con el objetivo de ofrecer una plataforma de debate y discusión sobre los temas tratados.

El contenido de Genética Médica es de carácter general y tiene una finalidad informativa. La mención de cualquier método, terapia, tratamiento o servicio no debe ser considerado una garantía para su utilización. Determinar el adecuado tratamiento para un paciente es responsabilidad de los médicos y facultativos. La información proporcionada en Revista Genética Médica ha sido diseñada para apoyar, y en ningún caso reemplazar, la relación que existe entre un paciente y su médico.

Para asegurar que todos los lectores tienen una buena experiencia, la Revista Genética Médica solicita que los comentarios sigan unas normas básicas. Los comentarios son evaluados antes de su publicación y moderados por los miembros de la Oficina Editorial de Revista Genética Médica diariamente. Cualquier comentario que no cumpla los principios indicados no será publicado.

Los comentarios están abiertos al público general por lo que los lectores deben considerar que su contenido no necesariamente ha sido realizado por un profesional médico.

Los usuarios tendrán en cuenta que los comentarios serán públicos y cualquier persona con acceso a internet podrá verlos. Los usuarios pueden publicar información personal propia (teniendo en cuenta que será pública) pero no la de otras personas. Los comentarios no podrán ser modificados.

Los principios seguidos para la publicación de comentarios serán:

  • Todos los comentarios que contribuyan a enriquecer el contenido y calidad de los contenidos de Revista Genética Médica serán bienvenidos. Los usuarios se comprometen a proporcionar información veraz y contrastable. Cada usuario proporcionará referencias y/o enlaces que justifiquen sus afirmaciones sobre medicina y salud, siempre que no se trate de una experiencia personal vivida por él mismo.
  • En caso de mencionar publicaciones científicas o datos específicos, se citarán las fuentes que en el comentario.
  • Sólo se aceptará la presencia de enlaces en los comentarios cuando su contenido cumpla los principios de publicación de comentarios y estén relacionados con el tema.
  • En caso de mencionar publicaciones científicas o datos específicos, se citarán las fuentes que en el comentario.
  • Sólo se aceptará la presencia de enlaces en los comentarios cuando su contenido cumpla los principios de publicación de comentarios y estén relacionados con el tema.
  • No se aceptarán comentarios difamatorios o falsos, insultos, amenazas, o ajenos al tema del que trate el artículo. En la misma línea no se aprobará la publicación de comentarios con contenido xenófobo, racista, sexista, homófobo o discriminatorio hacia cualquier religión o colectivo.
  • Los mensajes escritos al completo en mayúsculas no serán aceptados.
  • Mensajes publicitarios, o de cuestiones no relacionadas con el tema del artículo no serán aprobados para su publicación.

Si te ha gustado el artículo, suscríbete ahora de forma gratuita a la Revista Genética Médica y recíbela cada 2 semanas.

(function() { if (!window.mc4wp) { window.mc4wp = { listeners: [], forms : { on: function (event, callback) { window.mc4wp.listeners.push({ event : event, callback: callback }); } } } } })();


Acepto el Aviso Legal